Rat SFTPD/SP-D Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:RGG998-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1125bp
Gene Synonym
SPD, SP-D, Sftpd
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat surfactant protein D Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Surfactant pulmonary-associated protein D, also known as SFTPD and SP-D, is a member of the collectin family of C-type lectins that is synthesized in many tissues including respiratory epithelial cells in the lung, and contains one C-type lectin domain and one collagen-like domain. The polymorphic variation in the N-terminal domain of the SP-D molecule influences oligomerization, function, and the concentration of the molecule in serum. SFTPD is produced primarily by alveolar type II cells and nonciliated bronchiolar cells in the lung and is constitutively secreted into the alveoli where it influences surfactant homeostasis, effector cell functions, and host defense. It is upregulated in a variety of inflammatory and infectious conditions including Pneumocystis pneumonia and asthma. SFTPD is humoral molecules of the innate immune system, and is considered a functional candidate in chronic periodontitis. Besides it is involved in the development of acute and chronic inflammation of the lung. Several human lung diseases are characterized by decreased levels of bronchoalveolar SFTPD. Thus, recombinant SFTPD has been proposed as a therapeutical option for cystic fibrosis, neonatal lung disease and smoking-induced emphysema. Furthermore, SFTPD serum levels can be used as disease activity markers for interstitial lung diseases.
References
  • Leth-Larsen R, et al. (2005) A common polymorphism in the SFTPD gene influences assembly, function, and concentration of surfactant protein D. J Immunol. 174(3): 1532-8.
  • Moran AP, et al. (2005) Role of surfactant protein D (SP-D) in innate immunity in the gastric mucosa: evidence of interaction with Helicobacter pylori lipopolysaccharide. J Endotoxin Res. 11(6): 357-62.
  • Hartl D, et al. (2006) Surfactant protein D in human lung diseases. Eur J Clin Invest. 36(6): 423-35.
  • Krueger M, et al. (2006) Amino acid variants in Surfactant protein D are not associated with bronchial asthma. Pediatr Allergy Immunol. 17(1): 77-81.
  • Glas J, et al. (2008) Increased plasma concentration of surfactant protein D in chronic periodontitis independent of SFTPD genotype: potential role as a biomarker. Tissue Antigens. 72(1): 21-8.
  • TOP