Rat SerpinF2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_001011892.1

RefSeq ORF Size

1476bp

Gene Synonym

Serpinf2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SerpinF2, also known as alpha-2 antiplasmin (alpha-2 AP), is a member of the Serpin superfamily. SerpinF2 is the principal physiological inhibitor of serine protease plasmin, and as well as, an efficient inhibitor of trypsin and chymotrypsin. This protease is produced mainly by liver and kidney, and also expressed in muscle, intestine, central nervous system, and placenta also express this protein at a moderate level. It is indicated that Serpin F2 is a key regulator of plasmin-mediated proteolysis in these tissues. Alpha-2 AP is an unusual serpin in that it contains extensive N- and C-terminal sequences flanking the serpin domain. The N-terminal sequence is crosslinked to fibrin by factor XIIIa, whereas the C-terminal region mediates the initial interaction with plasmin. SerpinF2 is one of the inhibitors of fibrinolysis, which acts as the primary inhibitor of plasmin(ogen). It is a specific plasmin inhibitor, and is important in modulating the effectiveness and persistence of fibrin with respect to its susceptibility to digestion and removal by plasmin. Alpha-2 AP plays the dominant role in inhibiting both plasma clot lysis and thrombus lysis, and accordingly, the congenital deficiency of Alpha-2 antiplasmin causes a rare bleeding disorder because of increased fibrinolysis. Thus, it may be a useful target for developing more effective treatment of thrombotic diseases.

References

Lee KN, et al. (2004) Alpha2-antiplasmin: potential therapeutic roles in fibrin survival and removal. Curr Med Chem Cardiovasc Hematol Agents. 2(4): 303-10.

Matsuno H. (2006) Alpha2-antiplasmin on cardiovascular diseases. Curr Pharm Des. 12(7): 841-7.

Burnouf T, et al. (2007) Impact of Triton X-100 on alpha 2-antiplasmin (SERPINF2) activity in solvent/detergent-treated plasma. Biologicals. 35(4): 349-53.

Carpenter SL, et al. (2008) Alpha2-antiplasmin and its deficiency: fibrinolysis out of balance. Haemophilia. 14(6): 1250-4.

Catalog Number:RGG964-NF