Rat Selenoprotein M Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:RGG909-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
438bp
Gene Synonym
Selm
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat selenoprotein M Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Selenoprotein M is a selenoprotein, which contains a selenocysteine (Sec) residue at its active site. The selenocysteine M is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenoprotein genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This gene is expressed in a variety of tissues, and the protein is localized to the perinuclear structures. Selenoprotein M May function as a thiol-disulfide oxidoreductase that participates in disulfide bond formation. This protein is widely expressed and is highly expressed in brain. It is found in Cytoplasm, perinuclear region, Endoplasmic reticulum, Golgi apparatus. Localized to perinuclear structures corresponding to Golgi and endoplasmic reticulum. Experiments results have suggested that selenoprotein M may have an important role in protecting against oxidative damage in the brain and may potentially function in calcium regulation.
References
  • Reeves MA, et al. (2010) The neuroprotective functions of selenoprotein M and its role in cytosolic calcium regulation. Antioxid Redox Signal. 12(7): 809-18.
  • Lu W, et al. (2012) Reproductive function of Selenoprotein M in Chinese mitten crabs (Eriocheir sinesis). Peptides. 34(1): 168-76.
  • Garcia-Triana A, et al. (2010) Expression and silencing of Selenoprotein M (SelM) from the white shrimp Litopenaeus vannamei: effect on peroxidase activity and hydrogen peroxide concentration in gills and hepatopancreas. Comp Biochem Physiol A Mol Integr Physiol. 155(2): 200-4.
  • TOP