Rat Sclerostin/SOST Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:RGG855-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1314bp
Gene Synonym
VBCH, SOST
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat sclerosteosis Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Sclerostin, the protein product of the SOST gene, is a potent inhibitor of bone formation. Sclerostin protein is widely expressed at low levels with highest levels in bone, cartilage, kidney, liver, bone marrow and primary osteeoblasts differentiated for 21 days, and was originally identified as an important regulator of bone remodeling, homeostasis, and links bone resorption and bone apposition. Recent studies have revealed that Sclerostin protein inhibits the bone growth probably by binding to the extracellular domain of the Wnt coreceptors LRP5 and LRP6 and disrupting Wnt-induced Frizzled-LRP complex formation.
References
  • Bellido T. (2006) Downregulation of SOST/sclerostin by PTH: a novel mechanism of hormonal control of bone formation mediated by osteocytes. J Musculoskelet Neuronal Interact. 6(4): 358-9.
  • van Bezooijen RL, et al. (2007) SOST expression is restricted to the great arteries during embryonic and neonatal cardiovascular development. Dev Dyn. 236(2): 606-12.
  • TOP