Rat RCN3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001008694.2

RefSeq ORF Size

987bp

Gene Synonym

Rem1, Rlp49

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat reticulocalbin 3, EF-hand calcium binding domain Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

RCN3 belongs to the CREC family which contains multiple EF-hand Ca2+-binding proteins localized to the secretory pathway. RCN3 sequence is characterized by the presence of five Arg-Xaa-Xaa-Arg motifs, which represents the target sequence of subtilisin-like proprotein convertases(SPCs). SPCs are a family of seven structurally related serine endoproteases that are involved in the proteolytic activation of proproteins.RCN3 is transiently associated with proPACE4, but not with mature PACE4. Inhibition of PACE4 maturation by a Ca2+ ionophore resulted in accumulation of the proPACE4-RCN-3 complex in cells. It has been proposed that elective and transient association of RCN3 with the precursor of PACE4 plays an important role in the biosynthesis of PACE4.

References

Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.

Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.

Kamatani Y, et al. (2010) Genome-wide association study of hematological and biochemical traits in a Japanese population. Nat Genet. 42(3):210-5.

Catalog Number:RGG470-NY