Rat RBP4 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_013162.1

RefSeq ORF Size

606bp

Gene Synonym

RBPA, Rbp4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat retinol binding protein 4, plasma Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Retinol-binding protein 4 (RBP4) is the specific carrier for retinol (also known as vitamin A), and is responsible for the conversion of unstable and insoluble retinol in aqueous solution into stable and soluble complex in plasma through their tight interaction. As a member of the lipocalin superfamily, RBP4 containing a β-barrel structure with a well-defined cavity is secreted from the liver, and in turn delivers retinol from the liver stores to the peripheral tissues. In plasma, the RBP4-retinol complex interacts with transthyretin (TTR), and this binding is crucial for preventing RBP4 excretion through the kidney glomeruli. RBP4 expressed from an ectopic source efficiently delivers retinol to the eyes, and its deficiency affects night vision largely. Recently, RBP4 as an adipokine, is found to be expressed in adipose tissue and correlated with obesity, insulin resistance (IR) and type 2 diabetes (T2DM).

References

Yang Q, et al. (2005) Serum retinol binding protein 4 contributes to insulin resistance in obesity and type 2 diabetes. Nature. 436(7049): 356-62.

Choi SH, et al. (2008) High plasma retinol binding protein-4 and low plasma adiponectin concentrations are associated with severity of glucose intolerance in women with previous gestational diabetes mellitus. J Clin Endocrinol Metab. 93(8): 3142-8.

Tepper BJ, et al. (2010) Serum retinol-binding protein 4 (RBP4) and retinol in a cohort of borderline obese women with and without gestational diabetes. Clin Biochem. 43(3): 320-3.

Catalog Number:RGG455-CO