Rat RACK1/GNB2L1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:RGG375-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
954bp
Gene Synonym
RACK1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat guanine nucleotide binding protein (G protein), beta polypeptide 2 like 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
RACK1 (guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1), also known as GNB2L1, contains 7 WD repeats and belongs to the WD repeat G protein beta family. In the liver, RACK1 is expressed at higher levels in activated hepatic stellate cells than in hepatocytes or Kupffer cells. It is up-regulated in hepatocellular carcinomas and in the adjacent non-tumor liver tissue. RACK1 is involved in the recruitment, assembly and/or regulation of a variety of signaling molecules. It interacts with a wide variety of proteins and plays a role in many cellular processes. GNB2L1 binds to and stabilizes activated protein kinase C (PKC), increasing PKC-mediated phosphorylation. RACK1 may recruit activated PKC to the ribosome, leading to phosphorylation of EIF6. It inhibits the activity of SRC kinases including SRC, LCK and YES1. RACK1 also inhibits cell growth by prolonging the G0/G1 phase of the cell cycle. It enhances phosphorylation of BMAL1 by PRKCA and inhibits transcriptional activity of the BMAL1-CLOCK heterodimer.
References
  • Jannot G, et al.. (2011) The ribosomal protein RACK1 is required for microRNA function in both C. elegans and humans. EMBO Rep. 12(6):581-6.
  • Wang F, et al. (2011) RACK1 regulates VEGF/Flt1-mediated cell migration via activation of a PI3K/Akt pathway. J Biol Chem. 286(11):9097-106.
  • Cao XX, et al. (2011) RACK1 promotes breast carcinoma migration/metastasis via activation of the RhoA/Rho kinase pathway. Breast Cancer Res Treat. 126(3):555-63.
  • Myklebust LM, et al. (2011) Receptor for activated protein C kinase 1 (RACK1) is overexpressed in papillary thyroid carcinoma. Thyroid. 21(11):1217-25.
  • TOP