Rat RAC2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:RGG373-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
579bp
Gene Synonym
Rac2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ras-related C3 botulinum toxin substrate 2 (Rac2) is a small G-protein belonging to the Ras subfamily of the GTPase family. Rac2 acts as an "on / off" switch for signal transduction cascades and motilities. When GDP is attached to the small G-protein, the enzyme is inactivated. Release of the GDP and replace of the GTP cativate the GTPasee. Rac2 remains active until the GTP is hydrolyzed to GDP. Rac2 is a hematopoietic-specific Rho family GTPase implicated as an important constituent of the NADPH oxidase complex and shares 92% amino acid identity with the ubiquitously expressed Rac1. The small G-protein Rac2 regulates the rearrangements of actin and membrane necessary for Fcy receptor-mediated phagocytosis by macrophages. Activated Rac2 binds to the p21-binding domain of PAK1 and this binding provided a basis for microscopic methods to localize activation of these G proteins inside cells.
References
  • Adam D, et al. (2003) Cdc42, Rac1, and Rac2 Display Distinct Patterns of Activation during Phagocytosis.Mol Biol Cell. 15 (8 ): 3509-19.
  • Walmsley MJ, et al. (2003) Critical Roles for Rac1 and Rac2 GTPases in B Cell Development and Signaling. Science. 302 (5644): 459-62.
  • Holland M, et al. (2011) RAC2, AEP, and ICAM1 expression are associated with CNS disease in a mouse model of pre-B childhood acute lymphoblastic leukemia. Blood. 118 (3): 638-49.
  • TOP