Rat PROM1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGG149-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2481bp
Gene Synonym
Prom, CD133, MGC156650, Prom1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat prominin 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD133, also known as PROM1 and Prominin 1, is a pentaspan transmembrane glycoprotein which belongs to the prominin family. It localizes to membrane protrusions and is often expressed on adult stem cells. CD133 is known to play a role in maintaining stem cell properties by suppressing differentiation. CD133 binds cholesterol in cholesterol-containing plasma membrane microdomains. It is proposed to play a role in apical plasma membrane organization of epithelial cells. CD133 is also involved in regulation of MAPK and Akt signaling pathways. Mutations in PROM1 gene have been shown to result in retinitis pigmentosa and Stargardt disease. PROM1 gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Expression of this gene is also associated with several types of cancer.
References
  • Corbeil D. et al., 2001, Biochem Biophys Res Commun. 285 (4): 939-44.
  • Horn PA. et al., 1999, Blood. 93 (4): 1435-37.
  • Sanai N. et al., 2005, N Engl J Med. 353 (8): 811-22.
  • TOP