Rat PHYH Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_053674.1

RefSeq ORF Size

1017bp

Gene Synonym

Phyh

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat phytanoyl-CoA 2-hydroxylase Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

PHYH belongs to the family of iron(II)-dependent oxygenases, which typically incorporate one atom of dioxygen into the substrate and one atom into the succinate carboxylate group. PHYH is expressed in liver, kidney, and T-cells, but not in spleen, brain, heart, lung and skeletal muscle. It converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Defects in PHYH can cause Refsum disease (RD). RD is an autosomal recessive disorder characterized clinically by a tetrad of abnormalities: retinitis pigmentosa, peripheral neuropathy, cerebellar ataxia, and elevated protein levels in the cerebrospinal fluid (CSF). Patients exhibit accumulation of the branched-chain fatty acid, phytanic acid, in blood and tissues.

References

Mihalik SJ, et al. (1997) Identification of PAHX, a Refsum disease gene. Nat Genet. 17(2): 185-9.

McDonough MA, et al. (2005) Structure of human phytanoyl-CoA 2-hydroxylase identifies molecular mechanisms of Refsum disease. J Biol Chem. 280(49):41101-10.

Jansen GA, et al. (1998) Characterization of phytanoyl-Coenzyme A hydroxylase in human liver and activity measurements in patients with peroxisomal disorders. Clin Chim Acta. 271 (2):203-11.

Catalog Number:RGF829-NF