Rat PD-L1/B7-H1/CD274 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:RGF685-CG

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
873bp
Gene Synonym
Pdcd1lg1, RGD1566211, Cd274
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat CD274molecule Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Programmed death-1 ligand-1 (PD-L1, CD274, B7-H1) has been identified as the ligand for the immunoinhibitory receptor programmed death-1(PD1/PDCD1) and has been demonstrated to play a role in the regulation of immune responses and peripheral tolerance. PD-L1/B7-H1 is a member of the growing B7 family of immune molecules and this protein contains one V-like and one C-like Ig domain within the extracellular domain, and together with PD-L2, are two ligands for PD1 which belongs to the CD28/CTLA4 family expressed on activated lymphoid cells. By binding to PD1 on activated T-cells and B-cells, PD-L1 may inhibit ongoing T-cell responses by inducing apoptosis and arresting cell-cycle progression. Accordingly, it leads to growth of immunogenic tumor growth by increasing apoptosis of antigen specific T cells and may contribute to immune evasion by cancers. PD-L1 thus is regarded as promising therapeutic target for human autoimmune disease and malignant cancers.
References
  • Iwai Y, et al. (2002) Involvement of PD-L1 on tumor cells in the escape from host immune system and tumor immunotherapy by PD-L1 blockade. Proc Natl Acad Sci U S A. 99(19): 12293-7.
  • Ghebeh H, et al. (2006) The B7-H1 (PD-L1) T lymphocyte-inhibitory molecule is expressed in breast cancer patients with infiltrating ductal carcinoma: correlation with important high-risk prognostic factors. Neoplasia. 8(3): 190-8.
  • Salih HR, et al. (2006) The role of leukemia-derived B7-H1 (PD-L1) in tumor-T-cell interactions in humans. Exp Hematol. 34(7): 888-94.
  • Wilcox RA, et al. (2009) B7-H1 (PD-L1, CD274) suppresses host immunity in T-cell lymphoproliferative disorders. Blood. 114(10): 2149-58.
  • Ruggiero A, et al. (2009) Crystal structure of PD-L1, a ribosome inactivating protein from Phytolacca dioica L. leaves with the property to induce DNA cleavage. Biopolymers. 91(12): 1135-42.
  • TOP