Rat PARK7/DJ-1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:RGF619-NF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
570bp
Gene Synonym
Dj1, CAP1, DJ-1, SP22
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat parkinson protein 7 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Parkinson's disease locus DJ-1 (PARK7) is a differentially expressed transcript. DJ-1 plays a physiologic role in protection of erythroid cells from oxidant damage, a function unmasked in the context of oxidative stress. PARK7 belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Mutations in the DJ-1 gene are associated with rare forms of autosomal recessive early-onset Parkinson's disease (PD). DJ-1/p53 interactions contribute to apoptosis resistance in clonal myeloid cells and may serve as a prognostic marker in patients with myelodysplastic syndromes (MDS). DJ-1 regulates redox signaling kinase pathways and acts as a transcriptional regulator of antioxidative gene batteries. Therefore, DJ-1 is an important redox-reactive signaling intermediate controlling oxidative stress after ischemia, upon neuroinflammation, and during age-related neurodegenerative processes. Augmenting DJ-1 activity might provide novel approaches to treating chronic neurodegenerative illnesses such as Parkinson's disease and acute damage such as stroke.
References
  • Takahashi K, et al. (2001). DJ-1 positively regulates the androgen receptor by impairing the binding of PIASx alpha to the receptor. J. Biol. Chem. (United States). 276 (40): 37556-63.
  • Niki, Takeshi, et al. (2003). DJBP: a novel DJ-1-binding protein, negatively regulates the androgen receptor by recruiting histone deacetylase complex, and DJ-1 antagonizes this inhibition by abrogation of this complex. Mol. Cancer Res. (United States). 1 (4): 247-61.
  • Kahle PJ, et al. (2009) DJ-1 and prevention of oxidative stress in Parkinson's disease and other age-related disorders. Free Radic Biol Med. 47(10): 1354-61.
  • Xu X, et al. (2010) The familial Parkinson's disease gene DJ-1 (PARK7) is expressed in red cells and plays a role in protection against oxidative damage. Blood Cells Mol Dis. 45(3): 227-32.
  • Marcondes AM, et al. (2010) Identification of DJ-1/PARK-7 as a determinant of stroma-dependent and TNF-alpha-induced apoptosis in MDS using mass spectrometry and phosphopeptide analysis. Blood. 115(10): 1993-2002.
  • TOP