Rat NKG2A / NKG2 / CD159A / KLRC1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001037441.1

RefSeq ORF Size

711bp

Gene Synonym

rNKG2A, Klrc1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat killer cell lectin-like receptor subfamily C, member 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

NKG2, also known as NKG2A(CD159A), is a member of the killer cell lectin-like receptor family. This family is a group of transmembrane proteins preferentially expressed in NK cells. Members of this fmaily are characterized by the type II membrane orientation and the presence of a C-type lectin domain. NKG2 contains 1 C-type lectin domain and forms a complex with another family member, KLRD1/CD94. It is expressed only in NK-cells, but not in T-cells or B-cells. It has been shown that NKG2 represents a family of related cDNA clones, designated NKG2A, NKG2B, NKG2C, and NKG2D, which encode type 2 integral membrane proteins (extracellular C-terminus) containing a C-type lectin domain. Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NKG2 functions as a receptor for the recognition of MHC class I HLA-E molecules by NK cells and some cytotoxic T-cells.

References

Angelini DF, et al. (2011) NKG2A inhibits NKG2C effector functions of gamma delta T cells: implications in health and disease. J Leukoc Biol. 89(1):75-84.

Ge SJ, et al. (2011) Expression of NKG2D and NKG2A with their ligands MHC-I A/B and HLA-E in acute leukemia patients and its significance. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 19(2):312-6.

Ablamunits V, et al. (2011) NKG2A is a marker for acquisition of regulatory function by human CD8+ T cells activated with anti-CD3 antibody. Eur J Immunol. 41(7):1832-42.

Catalog Number:RGF294-NY