Rat Neuropilin-1/NRP1/CD304 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_145098.2

RefSeq ORF Size

2769bp

Gene Synonym

Nrp, Nrp1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat neuropilin 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Neuropilin is a type I transmembrane protein and the molecular mass is 120 kDa. Two homologues, Neuropilin-1 and Neuropilin-2, are identified. The primary structure of Neuropilin-1 and Neuropilin-2 is well conserved and is divided into four domains, CUB (a1/a2) domain, FV/FVIII (b1/b2) domain, MAM (c) domain, and (d) domain that contains a transmembrane and a short cytoplasmic region. Neuropilin-1 (NRP1) acts as a receptor for two different extracellular ligands, class 3 semaphorins and specific isoforms of vascular endothelial growth factor. The functions of NRP1 and NRP2 have been extensively studied in neurons where they act in axon guidance and in endothelial cells where they promote angiogenesis and cell migration. Neuropilin-1 is likely to mediate contacts between the dendritic cells and the T lymphocytes via homotypic interactions and is essential for the initiation of the primary immune response. NRP1 is a co-receptor for VEGF receptor-2 (VEGFR2) that enhances the binding of VEGF165 to VEGFR2 and VEGF165-mediated chemotaxis. NRP1 expression is regulated in EC by tumor necrosis factor-alpha, the transcription factors dHAND and Ets-1, and vascular injury. NRP1 upregulation is positively correlated with the progression of various tumors. Overexpression of NRPI in rat tumor cells results in enlarged tumors and substantially enhanced tumor angiogenesis. On the other hand, soluble NRP1 (sNRP1) is an antagonist of tumor angiogenesis.

References

Nakamura F, et al. (2002) Structural and functional relation of neuropilins. Adv Exp Med Biol. 515: 55-69.

Romeo PH, et al. (2002) Neuropilin-1 in the immune system. Adv Exp Med Biol. 515: 49-54.

Klagsbrun M, et al. (2002) The role of neuropilin in vascular and tumor biology. Adv Exp Med Biol. 515: 33-48.

Staton CA, et al. (2007) Neuropilins in physiological and pathological angiogenesis. J Pathol. 212(3): 237-48.

Bagri A, et al. (2009) Neuropilins in tumor biology. Clin Cancer Res. 15(6): 1860-4.

Catalog Number:RGF248-NM