Rat NCAM1 / CD56 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:RGF153-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2577bp
Gene Synonym
Cd56, Ncam, N-CAM, NCAMC, NCAM-1, NCAM-C, N-CAM-1, MGC124601, Ncam1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat neural cell adhesion molecule 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
NCAM1, also known as CD56, is a neural adhesion protein (NCAM) which belongs to the immunoglobulin superfamily. NCAM is involved in neural development and in plasticity in the adult brain. UCHL1 is a novel interaction partner of both NCAM isoforms that regulates their ubiquitination and intracellular trafficking. NCAM1 is a cell adhesion molecule involved in neuron-neuron adhesion, neurite fasciculation, outgrowth of neurites, etc. NCAM1 has also been shown to be involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance.
References
  • Reyes AA. et al., 1991, Mol Cell Biol. 11 (3): 1654-61.
  • Suzuki M. et al., 2003, J Biol Chem. 278 (49): 49459-68.
  • Becker C G. et al., 1996, J Neurosci Res. 45 (2): 143-52.
  • TOP