Rat MMP9/MMP-9/CLG4B Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_031055.1

RefSeq ORF Size

2127bp

Gene Synonym

Mmp9

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat matrix metallopeptidase 9 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Matrix metalloproteinases (MMPs) are neutral proteinases that are involved in the breakdown and remodeling of the extracellular matrix (ECM) under a variety of physiological and pathological conditions, such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. MMP9, also known as 92-kDa gelatinase B/type IV collagenase, is secreted from neutrophils, macrophages, and a number of transformed cells, and is the most complex family member in terms of domain structure and regulation of its activity. It plays an important role in tissue remodelling in normal and pathological inflammatory processes. MMP-9 is a major secretion product of macrophages and a component of cytoplasmic granules of neutrophils, and is particularly important in the pathogenesis of inflammatory, infectious, and neoplastic diseases in many organs including the lung. This enzyme is also secreted by lymphocytes and stromal cells upon stimulation by inflammatory cytokines, or upon delivery of bi-directional activation signals following integrin-mediated cell-cell or cell-extracellular matrix (ECM) contacts. Since the integrity of the tissue architecture is closely dependent of the delicate balance between MMPs and their inhibitors, excessive production of MMP-9 is linked to tissue damage and degenerative inflammatory disorders. As a consequence, regulation of gene transcription and tissue-specific expression of MMP-9 in normal and diseased states are being actively investigated to pave the way for new therapeutic targets. In addition, the dramatic overexpression of MMP-9 in cancer and various inflammatory conditions clearly points to the molecular mechanisms controlling its expression as a potential target for eventual rational therapeutic intervention.

References

St-Pierre Y, et al. (2003) Emerging features in the regulation of MMP-9 gene expression for the development of novel molecular targets and therapeutic strategies. Curr Drug Targets Inflamm Allergy. 2(3): 206-15.

St-Pierre Y, et al. (2004) Regulation of MMP-9 gene expression for the development of novel molecular targets against cancer and inflammatory diseases. Expert Opin Ther Targets. 8(5): 473-89.

Chakrabarti S, et al. (2005) Matrix metalloproteinase-2 (MMP-2) and MMP-9 in pulmonary pathology. Exp Lung Res. 31(6): 599-621.

Catalog Number:RGE903-CM