Rat MFG-E8 / lactadherin / MFGE8 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_012811.3

RefSeq ORF Size

1284bp

Gene Synonym

AGS, MFGME8, OAcGD3S, MFGMP-E8

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat milk fat globule-EGF factor 8 protein Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

MFG-E8, also known as lactadherin and MFGE8, contains 1 EGF-like domain and 2 F5/8 type C domains. It also contains a phosphatidylserine (PS) binding domain, as well as an Arginine-Glycine-Aspartic acid motif, which enables the binding to integrins. It binds PS, which is exposed on the surface of apoptotic cells. MFG-E8 is expressed in mammary epithelial cell surfaces and aortic media. Overexpression of MFG-E8 can be found in several carcinomas. MFG-E8 has an opsonization of the apoptotic cells and binding to integrins on the surface of phagocytic cells. It also mediates the engulfment of the dead cell. MFG-E8 plays an important role in the maintenance of intestinal epithelial homeostasis and the promotion of mucosal healing. It promotes VEGF-dependent neovascularization and contributes to phagocytic removal of apoptotic cells in many tissues. It also binds to phosphatidylserine-enriched cell surfaces in a receptor-independent manner.

References

Oshima K, et al. (2002) Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles. Eur J Biochem. 269(4):1209-18.

Hanayama R, et al. (2002) Identification of a factor that links apoptotic cells to phagocytes. Nature. 417 (6885):182-7.

Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.

Catalog Number:RGE822-CM