Rat MDHA / MDH1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_033235.1

RefSeq ORF Size

1005bp

Gene Synonym

MDL1, Mdhl, Mor2, Mdh1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat malate dehydrogenase 1, NAD (soluble) Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Malate dehydrogenases 1(MDH1 / MDHA) is soluable form of malate dehydrogenases. Malate dehydrogenases (MDH) is a group of multimeric enzymes consisting of identical subunits usually organized as either dimer or tetramers with subunit molecular weights of 30-35 kDa. MDH has been isolated from different sources including archaea, eubacteria, fungi, plant and mammals. MDH catalyzes the NAD/NADH-dependent interconversion of the substrates malate and oxaloacetate. This reaction plays a key part in the malate / aspartate shuttle across the mitochondrial membrane, and in the tricarboxylic acid cycle within the mitochondrial matrix. The enzymes share a common catalytic mechanism and their kinetic properties are similar, which demonstrates a high degree of structural similarity. The three-dimensional structures and elements essential for catalysis are conserved between mitochondrial and cytoplasmic forms of MDH in eukaryotic cells even though these isoenzymes are only marginally related at the level of primary structure.

References

Minarik P, et al. (2002) Malate dehydrogenases--structure and function. Gen Physiol Biophys. 21 (3): 257-65.

Musrati RA, et al. (1998) Malate dehydrogenase: distribution, function and properties. Gen Physiol Biophys. 17 (3): 193-210.

Hall MD, et al. (1992) Crystal structure of Escherichia coli malate dehydrogenase. A complex of the apoenzyme and citrate at 1.87 A resolution. J Mol Biol. 226 (3): 867-82.

Catalog Number:RGE750-CY