Rat MBL/MBL-2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_022704.2

RefSeq ORF Size

735bp

Gene Synonym

Ab2-001; Ab2-011

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat mannose-binding lectin (protein C) 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

MBL (mannose-binding lectin) is primarily a liver-derived collagen-like serum protein, which binds sugar structures on micro-organisms and on dying host cells and is one of the four known mediators that initiate activation of the complement system via the lectin pathway. MBL and the ficolins (Ficolin-1, Ficolin-2 and Ficolin-3) are soluble collagen-like proteins that are involved in innate immune defence. They bind sugar structures or acetylated compounds present on microorganisms and on dying host cells and they initiate activation of the lectin complement pathway in varying degrees. MBL2 encodes the mannose-binding lectin, which is a key player in the innate immune system and has recently been found to play a role in development of type 1 diabetes and gestational diabetes mellitus. Common variant alleles situated both in promoter and structural regions of the MBL2 gene influence the stability and the serum concentration of the protein. Several polymorphisms in the promoter and structural regions of MBL2 adversely affect the plasma concentration and oligomeric state of MBL. The possession of mutant alleles has been linked to disease outcome for a variety of bacterial and viral infections. Mutant MBL2 haplotypes have been linked to disease progression and response to therapy in HCV infection.

References

Garred P, et al. (2006) Mannose-binding lectin and its genetic variants. Genes Immun. 7(2): 85-94.

Brown KS, et al. (2007) Mannan binding lectin and viral hepatitis. Immunol Lett. 108(1): 34-44.

Garred P. (2008) Mannose-binding lectin genetics: from A to Z. Biochem Soc Trans. 36(Pt 6): 1461-6.

Garred P, et al. (2009) MBL2, FCN1, FCN2 and FCN3-The genes behind the initiation of the lectin pathway of complement. Mol Immunol. 46(14): 2737-44.

Muller YL, et al. (2010) Functional Variants in MBL2 Are Associated With Type 2 Diabetes and Pre-Diabetes Traits in Pima Indians and the Old Order Amish. Diabetes. 59(8): 2080-5.

Catalog Number:RGE715-NY