Rat LILRA5 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:RGE364-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
888bp
Gene Synonym
Lilrc1, Lilra5
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
LILRA5 is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LILR are a family of receptors possessing extracellular immunoglobulin domains. They are also known as CD85, ILTs and LIR, and can exert immunomodulatory effects on a wide range of immune cells. ILT-11 contains 2 Ig-like C2-type (immunoglobulin-like) domains. It can be detected n tissues of the hematopoietic system, including bone marrow, spleen, lymph node and peripheral leukocytes. Crosslink of ILT-11 on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses.
References
  • Wende H, et al. (2000) Extensive gene duplications and a large inversion characterize the human leukocyte receptor cluster. Immunogenetics. 51(8-9):703-13.
  • Jones DC, et al. (2009) Alternative mRNA splicing creates transcripts encoding soluble proteins from most LILR genes. Eur J Immunol. 39(11):3195-206.
  • Mosbruger TL, et al. (2010) Large-scale candidate gene analysis of spontaneous clearance of hepatitis C virus. J Infect Dis. 201(9):1371-80.
  • TOP