Rat LAMP-1/CD107a/LAMP1 Gene ORF cDNA clone expression plasmid,C terminal His tag

Catalog Number:RGE277-CH

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1224bp
Gene Synonym
LGP120, Lamp1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat lysosomal-associated membrane protein 1 Gene ORF cDNA clone expression plasmid,C terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Lysosome-associated membrane glycoprotein 1, also known as CD107 antigen-like family member A, CD107a, and LAMP1, is a single-pass type I membrane protein which belongs to the LAMP family. CD107a is expressed largely in the endosome-lysosome membranes of cells, but is also found on the plasma membrane (1-2% of total LAMP1). LAMP1 has been implicated in a variety of cellular functions, including cancer metastasis. It has been proposed LAMP1 serves as a therapeutic agent for some cancers, as well as a marker for lysosomal storage disorders and different cell types such as cytotoxic T cells. LAMP2, also known as CD107b, may also play a role in tumor cell metastasis and functions in the protection, maintenance, and adhesion of the lysosome. Cell surface LAMP1 and LAMP2 have been shown to promote adhesion of human peripheral blood mononuclear cells (PBMC) to vascular endothelium, therefore they are possibly involved in the adhesion of PBMCs to the site of inflammation. LAMP-1 is a glycoprotein highly expressed in lysosomal membranes. The present study was initiated to test LAMP-1 mRNA and protein levels in post mortem frontal cortex (area 8) of Alzheimer's disease (AD) stages I-IIA/B and stages V-VIC of Braak and Braak, compared with age-matched controls. LAMP-1 occurred in microglia and multinucleated giant cells in one AD case in whom amyloid burden was cleared following betaA-peptide immunization. In addition, LAMP-1 has been suggested to be a cell surface receptor for a specific amelogenin isoform, leucine-rich amelogenin peptide or LRAP. LAMP-1 can serve as a cell surface binding site for amelogenin on dental follicle cells and cementoblasts.
References
  • Parkinson-Lawrence EJ, et al. (2005) Immunochemical analysis of CD107a (LAMP-1). Cell Immunol. 236(1-2): 161-6.
  • Barrachina M, et al. (2006) Lysosome-associated membrane protein 1 (LAMP-1) in Alzheimer's disease. Neuropathol Appl Neurobiol. 32(5): 505-16.
  • Zhang H, et al. (2010) Full length amelogenin binds to cell surface LAMP-1 on tooth root/periodontium associated cells. Arch Oral Biol. 55(6): 417-25.
  • TOP