Rat LAIR1/LAIR-1/CD305 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:RGE272-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
792bp
Gene Synonym
Lair1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat leukocyte-associated immunoglobulin-like receptor 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Leukocyte associated Ig-like receptor-1 (LAIR1) is a surface molecule expressed on human mononuclear leukocytes that functions as an inhibitory receptor on human NK cells. In addition to NK cells, LAIR1 is expressed on T cells, B cells, macrophages, and dendritic cells. It is predicted to mediate inhibitory functions based on the presence of immunoreceptor tyrosine-based inhibitory motifs (ITIMs) in its cytoplasmic domain. Cross-linking of LAIR1 on human T cell clones results in inhibition of cytotoxicity only in T cell clones that lack CD28 and are able to spontaneously lyse certain targets in vitro. Moreover, the cytolytic activity of freshly isolated T cells, which is thought to be mainly due to "effector" T cells, can be inhibited by anti-LAIR1 mAb. Thus, LAIR1 functions as an inhibitory receptor not only on NK cells, but also on human T cells. This indicates that LAIR1 provides a mechanism of regulation of effector T cells and may play a role in the inhibition of unwanted bystander responses mediated by Ag-specific T cells. 
References
  • Meyaard L, et al. (1999) Leukocyte-associated Ig-like receptor-1 functions as an inhibitory receptor on cytotoxic T cells. J Immunol. 162 (10): 5800-4.
  • Meyaard L, et al. (2001) The epithelial cellular adhesion molecule (Ep-CAM) is a ligand for the leukocyte-associated immunoglobulin-like receptor (LAIR). J Exp Med. 194 (1): 107-12.
  • Xu M, et al. (2000) Identification and characterization of leukocyte-associated Ig-like receptor-1 as a major anchor protein of tyrosine phosphatase SHP-1 in hematopoietic cells. J Biol Chem. 275 (23): 17440-6.
  • TOP