Rat KSP-Cadherin/Cadherin-16 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001012055.1

RefSeq ORF Size

2493bp

Gene Synonym

Cdh16

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat cadherin 16 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

KSP-Cadherin/Cadherin-16 is a member of the cadherin superfamily, calcium-dependent, membrane-associated glycoproteins. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. KSP-Cadherin/Cadherin-16 can be detected at later stages of tubulogenesis during human renal development and in the distal tubules of adult kidneys, no expression was found by immunohistochemistry or Western blot analysis in RCC tumour tissues and several RCC cell lines. However, despite the lack of protein expression, mRNA synthesis of KSP-Cadherin/Cadherin-16 could be detected by reverse transcriptase-polymerase chain reaction analysis in all RCC tissues and most of the RCC cell lines studied, although at a reduced level. The loss of KSP-Cadherin/Cadherin-16 protein was only observed in the malignant part of the tumour kidneys, whereas in the normal part of the affected kidneys KSP-Cadherin/Cadherin-16 expression was clearly detected. These results indicate a downregulation of Ksp-cadherin in RCC and suggest a role for this cell adhesion molecule in tumour suppression.

References

Thomson RB, et al. (1999) Immunolocalization of Ksp-cadherin in the adult and developing rabbit kidney. Am J Physiol. 277 (1): 146-56.

Thedieck C, et al. (2005) Expression of Ksp-cadherin during kidney development and in renal cell carcinoma. Br J Cancer. 92(11): 2010-7.

Bai Y, et al. (2002) Regulation of kidney-specific Ksp-cadherin gene promoter by hepatocyte nuclear factor-1beta. Am J Physiol Renal Physiol. 283(4): 839-51.

Catalog Number:RGE253-CM