Rat KRT14 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001008751.1

RefSeq ORF Size

1458bp

Gene Synonym

Ka14, Krt1-14

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat keratin 14 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cytokeratin 14, also known as Keratin 14 and K14, is a member of the keratin family. Cytokeratin 14 is a type I keratin. It is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Cytokeratin 14 is mainly expressed in the basal layer. It is also strongly expressed in the outer root sheath of anagen follicles. Cytokeratin 14 and keratin 5 may have a role in maintenance of cell proliferation potential in the basal layer of stratified epithelia, modulating phosphatidylinositol 3-kinase/Akt–mediated cell proliferation and/or Notch1-dependent cell differentiation. Cytokeratin 14 defect prevents it from working effectively with keratin 5 and interfering with the assembly of the keratin intermediate filament network. A disruption in this network makes keratinocytes fragile and prone to rupture. Minor trauma to the skin, such as rubbing or scratching, can cause these cells to break down, resulting in the formation of painful, fluid-filled blisters. Mutations in the K14 gene are also responsible for Naegeli-Franceschetti-Jadassohn syndrome and dermatopathia pigmentosa reticularis.

References

Coulombe PA, et al., 1991, Cell. 66(6): 1301-11.

Schweizer J, et al., 2006, 174(2): 169-74.

Lugassy J, et al., 2006, Am J Hum Genet. 79(4): 724-30.

Catalog Number:RGE227-CY