Rat KNG1/Kininogen 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:RGE212-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1293bp
Gene Synonym
Kng, Tkg, Kngk, Kngt, Map1, TKG6, KINKG, KINKH, Kngt1, KINT1G, Kng_v1, Kng1_v1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat kininogen 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Kininogen-1, also known as high molecular weight kininogen, williams-Fitzgerald-Flaujeac factor, Alpha-2-thiol proteinase inhibitor, Fitzgerald factor, KNG1 and BDK, is a secreted protein which contains three cystatin domains. Kininogen-1 / KNG1 is a protein from the blood coagulation system as well as the kinin-kallikrein system. It is a protein that adsorbs to the surface of biomaterials that come in contact with blood. Kininogen-1 / KNG1 circulates throughout the blood and quickly adsorbs to the material surfaces. Kininogen-1 / KNG1 is one of the early participants of the intrinsic pathway of coagulation, together with Factor XII (Hageman factor) and prekallikrein. Kininogen-1 / KNG1 is one of the kininogens, a class of proteins. As with many other coagulation proteins, the protein was initially named after the patients in whom deficiency was first observed. When the clinical data were combined, it turned out that all patients, in fact, had a deficiency of the same protein. Defects in KNG1 are the cause of high molecular weight kininogen deficiency (HMWK deficiency) which is an autosomal recessive coagulation defect. Patients with HWMK deficiency do not have a hemorrhagic tendency, but they exhibit abnormal surface-mediated activation of fibrinolysis.
References
TOP