Rat IL4/IL-4/Interleukin-4 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:RGD955-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
444bp
Gene Synonym
Il4e12, Il4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 4 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
KpnI + XbaI (6kb + 0.47kb)
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-4, also known as IL4, is a secreted protein which belongs to the IL-4 / IL-13 family. Interleukin-4 / IL4 has many biological roles, including the stimulation of activated B-cell and T-cell proliferation. It enhances both secretion and cell surface expression of IgE and IgG1. Interleukin-4 / IL4 also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Interleukin-4 is essential for the switching of B cells to IgE antibody production and for the maturation of T helper (Th) cells toward the Th2 phenotype. It participates in at least several B-cell activation processes as well as of other cell types. However, studies show that double mutant (Q116D, Y119D) of the murine IL4 protein (QY), both glutamine 116 and tyrosine 119, which binds to the IL4 receptor alpha, completely inhibites in a dose-dependent manner the IL4-induced proliferation of lipopolysaccharide-stimulated murine splenic B-cells, of the murine T cell line CTLL-2, and of the murine pre-B-cell line BA/F3. QY also inhibited the IL4-stimulated up-regulation of CD23 expression by lipopolysaccharide-stimulated murine splenic B-cells and abolished tyrosine phosphorylation of the transcription factor Stat6 and the tyrosine kinase Jak3 in IL4-stimulated BA/F3 cells.
References
  • Grunewald SM. et al., 1998, J Immunol. 160 (8): 4004-9.
  • Susanne M. et al, 1997, THE JOURNAL OF BIOLOGICAL CHEMISTRY. 272 (3): 1480-3.
  • Nishikubo K. et al., 2003, Gene Ther. 10 (26): 2119-25.
  • TOP