Rat IL20RB Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_001173438.1

RefSeq ORF Size

927bp

Gene Synonym

IL20R2, RGD1566151, Il20rb

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 20 receptor beta Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

IL20RB belongs to the type II cytokine receptor family. There are two kinds of type II cytokine receptors : cytokine receptors that bind type I and type II interferons; cytokine receptors that bind members of the interleukin-10 family (interleukin-10, interleukin-20 and interleukin-22). Type II cytokine receptors are similar to type I cytokine receptors except they do not possess the signature sequence WSXWS that is characteristic of type I receptors. They are expressed on the surface of certain cells, which bind and respond to a select group of cytokines. These receptors are related predominantly by sequence similarities in their extracellular portions that are composed of tandem Ig-like domains. The intracellular domain of type II cytokine receptors is typically associated with a tyrosine kinase belonging to the Janus kinase (JAK) family. IL20RB and IL20RA (MIM 605620) form a heterodimeric receptor for interleukin-20.

References

Zhu H, et al. (2009) Expression pattern of mda-7/IL-24 receptors in liver cancer cell lines. Hepatobiliary Pancreat Dis Int. 8(4):402-6.

Logsdon NJ, et al. (2012) Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex. Acta Crystallogr Sect F Struct Biol Cryst Commun. 68(Pt 1):89-92.

Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5):445-51.

Catalog Number:RGD945-CF