Rat IL20RA/IL-20RA Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:RGD944-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1632bp
Gene Synonym
Il20ra, Il20ra_predicted
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 20 receptor, alpha Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin 20 receptor, alpha subunit (IL20RA/IL-20RA) also known as IL-20 receptor subunit alpha, Cytokine receptor class-II member 8, interleukin-20 receptor I, and interleukin-20 receptor subunit alpha, is a subunit for the interleukin-20 receptor. IL20RA/IL-20RA belongs to the type II cytokine receptor family. This cytokine is a receptor for interleukin 20 (IL20), a cytokine that may be involved in epidermal function. The receptor of IL20 is a heterodimeric receptor complex consisting of this protein and interleukin 20 receptor beta (IL20B). IL20RA forms heterodimer with IL20RB, and the complex serves as a receptor for IL19, IL20 and IL24. All three are capable of signaling through IL-20RA/IL-20RB complex. The ligand binding to receptor B creating a high-affinity binding site for the receptor A which is recruited to complete the complex. In addition, IL20RA also forms a heterodimer with the unique and specific receptor IL10RB and functions as the receptor for IL26. IL20RA is widely expressed with highest levels in skin, testis and brain. The expression of both IL20RA and IL20RB is found to be upregulated in psoriatic skin lesions on keratinocytes.
References
  • Parrish-Novak J, et al. (2002) Interleukins 19, 20, and 24 signal through two distinct receptor complexes. Differences in receptor-ligand interactions mediate unique biological functions. J Biol Chem. 277(49): 47517-23.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5): 445-51.
  • Blumberg H, et al. (2001) Interleukin 20: discovery, receptor identification, and role in epidermal function. Cell. 104(1): 9-19.
  • TOP