Rat IL2/IL-2/Interleukin-2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:RGD943-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
468bp
Gene Synonym
IL2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-2, also known as T-cell growth factor, TCGF, Aldesleukin and IL2, is a secreted protein which belongs to the IL-2 family. Interleukin-2 / IL-2 was the first interleukin molecule to be discovered. Interleukin-2 / IL-2 molecule was first purified to homogeneity by immunoaffinity chromatography by Kendall Smith and his team at Dartmouth Medical School. Interleukin-2 / IL-2 was also the first cytokine shown to mediate its effects via a specific IL-2 receptor, and it was also the first interleukin to be cloned and expressed from a complementary DNA (cDNA) library. Interleukin-2 / IL-2 was designated number 2 because Smith's data at the time indicated that IL-1, produced by macrophages, facilitates IL-2 production by T lymphocytes (T cells).
Interleukin-2 / IL-2 is produced by T-cells in response to antigenic or mitogenic stimulation, this protein is required for T-cell proliferation and other activities crucial to regulation of the immune response. Interleukin-2 / IL-2 is normally produced by the body during an immune response. When environmental substances (molecules or microbes) gain access to the body, these substances (termed antigens) are recognized as foreign by antigen receptors that are expressed on the surface of lymphocytes. Antigen binding to the T cell receptor (TCR) stimulates the secretion of Interleukin-2 / IL-2, and the expression of IL-2 receptors IL-2R. The IL-2 / IL-2R interaction then stimulates the growth, differentiation and survival of antigen-selected cytotoxic T cells via the activation of the expression of specific genes. Interleukin-2 / IL-2 can stimulate B-cells, monocytes, lymphokine-activated killer cells, natural killer cells, and glioma cells. The World Reference Standard for Interleukin-2 / IL-2 is produced by the National Institute of Biological Standards and Control in the UK. A recombinant form of Interleukin-2 / IL-2 for clinical use is manufactured by Chiron Corporation with the brand name Proleukin. It has been approved by the Food and Drug Administration (FDA) for the treatment of cancers (malignant melanoma, renal cell cancer), and is in clinical trials for the treatment of chronic viral infections, and as a booster (adjuvant) for vaccines. The use of Interleukin-2 / IL-2 in HIV therapy has been found to be ineffective.
References
  • Smith KA, et al.,1980,  J. Exp. Med.151 (6): 1551-6. 
  • Smith KA, et al.,1980, Nature. 287 (5785): 853-5.
  • Taniguchi T, et al.,1983, Nature. 302 (5906): 305.
  • Cantrell DA, et al.,1984, Science. 224 (4655): 1312-6. 
  • Smith KA, et al.,1988, Science. 240 (4856): 1169-76.
  • Wang X. et al., 2005, Science 310:1159-63.
  • Stauber D.J. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 2788-93.
  • TOP