Rat IL1R1/IL-1R1/IL-1 RI Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:RGD940-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1773bp
Gene Synonym
Il1r1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 1 receptor, type I Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin 1 receptor, type I (IL-1R1) also known as CD121a (Cluster of Differentiation 121a), is an interleukin receptor. IL-1R1/CD121a is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein is a receptor for interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I (IL1R1/IL1RA). IL-1R1/CD121a is an important mediator involved in many cytokine induced immune and inflammatory responses. This protein has been characterized by pharmacological and molecular techniques in the mouse brain. The spindle-shaped astrocytes enclose the wound, separating the healthy from damaged neural tissue. The shape change and subsequent repair processes are IL-1β activity-dependent, acting through the IL-1 type 1 receptor (IL-1R1), as co-application of the IL-1type 1 receptor antagonist protein (IL-1ra) blocks IL-1β induced effects. In the spleen, a slight increase in IL-1R AcP and IL-1R1 was observed during the first hours following LPS stimulation. In conclusion, IL-1R AcP mRNA is expressed in the brain and in other tissues where IL-1R1/CD121a transcripts are found. However, the regulation of its expression is distinct from IL-1R1/CD121a. The high level of expression and the lack of regulation of IL-1R AcP transcripts in the brain under inflammatory conditions suggest that the protein might be constitutively expressed in excess.
References
  • Dale M, et al. (1999). "Interleukin-1 receptor cluster: gene organization of IL1R2, IL1R1, IL1RL2 (IL-1Rrp2), IL1RL1 (T1/ST2), and IL18R1 (IL-1Rrp) on human chromosome 2q.". Genomics 57 (1): 177-9.
  • Joos L, et al. (2001). "Association of IL-1beta and IL-1 receptor antagonist haplotypes with rate of decline in lung function in smokers.". Thorax 56 (11): 863-6.
  • Vigers GP, et al. (1997). "Crystal structure of the type-I interleukin-1 receptor complexed with interleukin-1beta.". Nature 386 (6621): 190-4.
  • TOP