Rat IL1B/IL-1B/IL-1 beta Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:RGD937-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
852 bp
Gene Synonym
Il1b
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 1 beta Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
KpnI + XbaI(6kb+0.85kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-1 beta (IL1 beta or IL1B) also known as catabolin, is a member of the interleukin 1 cytokine family. IL1 is a pleiotropic cytokine. It is involved in the inflammatory response, cell growth, and tissue repair in the cortex. The IL1 superfamily consists of three members, IL1A (IL1 alpha), IL1B (IL1 beta), and IL1 receptor antagonist (IL1Ra). In clinical, it has been reported that Interleukin (IL)-1 may influence Th1 / Th2 immune responsiveness and has been implicated in the establishment of successful pregnancy. Proinflammatory interleukin (IL)-1 gene polymorphisms associated with high levels of IL-1beta activity increase the risk for hypochlorhydria and distal gastric carcinoma. IL1B polymorphisms may be involved in susceptibility to SSc. Moreover, the IL2-384-G allele may be a marker for the limited phenotype of systemic sclerosis (SSc).
References
  • Kim SH, et al. (2008) Association of -31TC and -511 CT polymorphisms in the interleukin 1 beta (IL1B) promoter in Korean keratoconus patients. Mol Vis. 14:2109-16.
  • Wang ZC, et al. (2002) T helper 1-type immunity to trophoblast antigens in women with a history of recurrent pregnancy loss is associated with polymorphism of the IL1B promoter region. Genes Immun. 3(1): 38-42.
  • Mattuzzi S, et al. (2007) Association of polymorphisms in the IL1B and IL2 genes with susceptibility and severity of systemic sclerosis. J Rheumatol. 34(5): 997-1004.
  • TOP