Rat IL17RA/IL-17RA/CD217 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGD930-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2607bp
Gene Synonym
Il17r, Il17ra
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 17 receptor A Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-17 receptor (IL-17R), also known as Interleukin-17 receptor A (IL-17RA) and CD217 antigen (CD217), is a cytokine receptor which binds interleukin 17. IL-17R/IL-17RA (CD217) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. IL-17R/IL-17RA (CD217) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor IL-17RA play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Defects in IL-17R/IL-17RA (CD217) are the cause of familial candidiasis type 5 (CANDF5). CANDF5 is a rare disorder with altered immune responses and impaired clearance of fungal infections, selective against Candida. It is characterized by persistent and/or recurrent infections of the skin, nails and mucous membranes caused by organisms of the genus Candida, mainly Candida albicans.
References
  • Gaffen SL. (2009) Structure and signalling in the IL-17 receptor family. Nat Rev Immunol. 9 (8): 556-67.
  • Johansen C, et al.. (2009) Characterization of the interleukin-17 isoforms and receptors in lesional psoriatic skin. Br J Dermatol. 160 (2): 319-24.
  • Yao Z, et al.. (1997) Molecular characterization of the human interleukin (IL)-17 receptor. Cytokine 9 (11): 794-800.
  • TOP