Rat IL13RA2 / CD213A2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_133538.1

RefSeq ORF Size

1158bp

Gene Synonym

Il13ra2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 13 receptor, alpha 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin-13 receptor subunit alpha-2 (IL13RA2/IL-13RA2) is also known as also known as cluster of differentiation 213A2 (CD213A2), IL-13 receptor subunit alpha-2, IL-13R subunit alpha-2, and IL-13RA2. The IL13RA2 is often overexpressed in brain tumors, making Il13ra2 one of the vaccine targets for immunotherapy of glioma. IL13RA2/IL-13RA2 is a cancer-associated receptor that is present in greater than 80% of High Grade Astrocytomas (HGA) and has recently been recognized as a cytokine that predisposes breast cancer cells to metastasize. Expression of IL13Rα2 was rapidly lost from the surface of transduced cells grown in culture. The loss appeared to be related to ligands present in fetal bovine serum in the medium. None of the malignant glioma cell lines cultivated in vitro and tested to date exhibited the IL13Rα2 receptor. A recombinant virus (R5111) enters cells via its interaction with the IL13Rα2 receptor in a manner that cannot be differentiated from the interaction of wild-type virus with its receptors.

References

Zhou G, et al.. (2005) Characterization of a recombinant herpes simplex virus 1 designed to enter cells via the IL13Ralpha2 receptor of malignant glioma cells. J Virol. 79(9): 5272-7.

Osawa M, et al.. (2000) Characterization of the mouse interleukin-13 receptor alpha1 gene. Immunogenetics. 51(11): 974-81.

Nair BG, et al.. (2011) Nanotechnology platforms; an innovative approach to brain tumor therapy. Med Chem. 7(5): 488-503.

Benson M, et al.. (2006) A network-based analysis of the late-phase reaction of the skin. J Allergy Clin Immunol. 118(1): 220-5.

Catalog Number:RGD922-CY