Rat IL13/IL-13/ALRH Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:RGD920-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
396bp
Gene Synonym
IL13
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 13 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin 13 (IL-13) is a single-chain glycosylated polypeptide, which belongs to the IL-13/IL-4 family. IL-13 protein is secreted by many cell types, but especially by T helper type 2 (Th2) cells. IL-13 exerts its effects through a multi-subunit receptor comprising the alpha chain of the IL-4 receptor (IL-4Rα) and at least one of two known IL-13-specific binding chains (IL-13 Rα1 and IL-13 Rα2). As a cytokine, IL-13 protein is critical in regulating inflammatory, immune responses and diseases. In addition, it inhibits the production of pro-inflammatory cytokines and chemokines, and thus down-regulates macrophage activity. IL-13 protein and antibody is more importantly implicated as a central mediator of immunoregulatory processes in various cell types.
References
  • Junttila IS, et al. (2008) Tuning sensitivity to IL-4 and IL-13: differential expression of IL-4Ralpha, IL-13Ralpha1, and gammac regulates relative cytokine sensitivity. J Exp Med. 205(11): 2595-608.
  • Shimamura T,et al. (2008) Novel role of IL-13 in fibrosis induced by nonalcoholic steatohepatitis and its amelioration by IL-13R-directed cytotoxin in a rat model. J Immunol. 181(7): 4656-65.
  • TOP