Rat IL12RB2 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:RGD919-NG

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2610bp
Gene Synonym
Il12rb2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 12 receptor, beta 2 Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-12 receptor subunit beta-2 (IL12RB2), also known as IL-12 receptor subunit beta-2, IL-12R subunit beta-2, IL-12R-beta-2, and IL-12RB2, is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. IL12RB2 belongs to the type I cytokine receptor family. The coexpression of IL12RB2 and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of IL12RB2 is up-regulated by IFN gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of IL12RB2 is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. This subunit is the signaling component coupling to the JAK2/STAT4 pathway. IL12RB2 promotes the proliferation of T-cells as well as NK cells. IL12RB2 induces the promotion of T-cells towards the Th1 phenotype by strongly enhancing IFN-gamma production.
References
  • Yamamoto K, et al. (1997) Assignment of IL12RB1 and IL12RB2, interleukin-12 receptor beta 1 and beta 2 chains, to human chromosome 19 band p13.1 and chromosome 1 band p31.2, respectively, by in situ hybridization. Cytogenet. 77 (3-4): 257-8.
  • Morton SM, et al. (1998) Assignment of IL12RB2 to human chromosome 1p31.3→p31.2 between D1S230 and D1S198. Cytogenet. Cell Genet. 79 (3-4): 282-3.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci USA. 99 (26): 16899-903.
  • TOP