Rat IL10RB / IL-10RB Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_001107111.1

RefSeq ORF Size

1056bp

Gene Synonym

RGD1560373, Il10rb

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 10 receptor, beta Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin 10 receptor, beta subunit (IL10RB/IL-10RB) also known as Cytokine receptor family 2 member 4, Interleukin-10 receptor subunit 2, and cytokine receptor family II, member 4, is a subunit for the interleukin-10 receptor. IL10RB/IL-10RB belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 10 receptor complex. Coexpression of this and IL10RA proteins has been shown to be required for IL10-induced signal transduction. Defects in IL10RB/IL-10RB are the cause of inflammatory bowel disease type 25 (IBD25). It is a chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. It is subdivided into Crohn disease and ulcerative colitis phenotypes. Crohn disease may affect any part of the gastrointestinal tract from the mouth to the anus, but most frequently it involves the terminal ileum and colon. Bowel inflammation is transmural and discontinuous; it may contain granulomas or be associated with intestinal or perianal fistulas. In contrast, in ulcerative colitis, the inflammation is continuous and limited to rectal and colonic mucosal layers; fistulas and granulomas are not observed. Both diseases include extraintestinal inflammation of the skin, eyes, or joints.

References

Josephson K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15 (1): 35-46.

Yoo KH, et al. (2011) Association of IL10, IL10RA, and IL10RB polymorphisms with benign prostate hyperplasia in Korean population. J Korean Med Sci. 26(5): 659-64.

Catalog Number:RGD911-CF