Rat IL10/IL-10/Interleukin-10 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:RGD910-NG

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
537bp
Gene Synonym
IL10X, Il10
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 10 Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
KpnI + XbaI (6kb + 0.58kb)
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
IL-10 is a anti-inflammatory cytokine which belongs to the IL-10 family. It is produced by a variety of cell lines, including T-cells, macrophages, mast cells and other cell types, while it is produced primarily by monocytes and to a lesser extent by lymphocytes. IL-10 is mainly expressed in monocytes and Type 2 T helper cells (TH2), mast cells, CD4+CD25+Foxp3+ regulatory T cells, and also in a certain subset of activated T cells and B cells. IL-10 has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. IL-10 can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. The importance of interleukin 10 for counteracting excessive immunity in the human body is revealed by the fact that patients with Crohn's disease react favorably towards treatment with bacteria producing recombinant IL-10. IL-10 inhibits the synthesis of a number of cytokines, including IFN-gamma, IL-2, IL-3, TNF and GM-CSF produced by activated macrophages and by helper T-cells. It also displays a potent ability to suppress the antigen-presentation capacity of antigen presenting cells. However, it is also stimulatory towards certain T cells and mast cells and stimulates B cell maturation and antibody production.
References
  • Arimoto T, et al. (2007) Interleukin-10 protects against inflammation-mediated degeneration of dopaminergic neurons in substantia nigra. Neurobiol Aging. 28(6):894-906.
  • Han X, et al. (2010) Effect of cobalt protoporphyrin on hyperexpression of heme oxygenase-1 and secretion of IL-10 in rat bone marrow mesenchymal stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 18(5):1297-301.
  • Cui QQ, et al. (2011) Expression of RhoA in the lung tissue of acute lung injury rats and the influence of RhoA on the expression of IL-8 and IL-10. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 77(7): 1436-41.
  • TOP