Rat IFNA5/IFNaG Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

XM_001076062.1

RefSeq ORF Size

570bp

Gene Synonym

Ifna5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interferon alpha family, gene 5 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interferon, alpha 5 (IFNA5) belongs to the alpha/beta interferon family. IFNA5 is the only IFNA subtype detected in normal liver, while a mixture of subtypes is observed in the liver tissue of patients with chronic hepatitis C. Interferons are produced by macrophages, IFN-alpha have antiviral activities. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. IFN-alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation.

References

Lau JY, et al. (1993) Discrepancy between biochemical and virological responses to interferon-alpha in chronic hepatitis C. Lancet. 342(8881): 1208-9.

Kessler DS, et al. (1990) Interferon-alpha regulates nuclear translocation and DNA-binding affinity of ISGF3, a multimeric transcriptional activator. Genes Dev. 4(10): 1753-65.

Gutterman JU. Cytokine therapeutics: lessons from interferon alpha. Proc Natl Acad Sci U S A. 91(4): 1198-205.

Catalog Number:RGD815-CM