Rat IFN-alpha / IFNA1 / IFN Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:RGD811-NG

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
579bp
Gene Synonym
IFN-alpha1, Ifna1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interferon-alpha 1 Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
IFNA1, also known as IFN-alpha and IFNA, belongs to the alpha/beta interferon family. Interferons(IFNs) are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumor cells. They belong to the large class of glycoproteins known as cytokines. IFNs stimulate the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs can activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they also increase the ability of uninfected host cells to resist new infection by virus.Leukocyte interferon is produced predominantly by B lymphocytes. Immune interferon is produced by mitogen- or antigen-stimulated T lymphocytes. IFNA1 is produced by macrophages and has antiviral activities.
References
  • Takayama I, et al. (2012) The nucleocapsid protein of measles virus blocks host interferon response. Virology. 424(1):45-55.
  • Vairo D, et al. (2011) Severe impairment of IFN-? and IFN-? responses in cells of a patient with a novel STAT1 splicing mutation. Blood. 118(7):1806-17.
  • Bhattacharya S, et al. (2011) Bcr-abl signals to desensitize chronic myeloid leukemia cells to IFN? via accelerating the degradation of its receptor. Blood. 118(15):4179-87.
  • TOP