Rat HVEM/TNFRSF14/CD270 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:RGD765-NH

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
837bp
Gene Synonym
TNFRSF14
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 14 Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Herpesvirus entry mediator (HVEM), also referred to as TNFRSF14, TR2 (TNF receptor-like molecule) and ATAR (another TRAF-associated receptor), is a member of type I transmembrane protein belonging to the TNF-receptor superfamily. It is expressed on many immune cells, including T and B cells, NK cells, monocytes, and neutrophils. Two TNF superfamily ligands lymphotoxin α (TNF-β) and LIGHT (TNFSF14) are identified as cellular ligands for HVEM and initiate the positive signaling. However, recent studies have revealed that HVEM is also involved in the unique inhibitory signaling pathway for T cells through activating tyrosine phosphorylation of the immunoreceptor tyrosine-based inhibitory motif (ITIM) in B and T lymphocyte attenuator (BTLA). HVEM provides a stimulatory signal following engagement with LIGHT (TNFSF14) on T cells. In contrast, it can also provide an inhibitory signal to T cells when it binds the B and T lymphocyte attenuator (BTLA), a ligand member of the Immunoglobulin (Ig) superfamily. Thus, HVEM may be viewed as a molecular switch, capable of facilitating both stimulatory and inhibitory cosignaling in T cells. Substantial evidence from both human disease and from experimental mouse models has indicated that dysregulation of the LIGHT-HVEM-BTLA cosignaling pathway can cause inflammation in the lung and in mucosal tissues.
References
  • Murphy KM, et al. (2006) Balancing co-stimulation and inhibition with BTLA and HVEM. Nat Rev Immunol. 6(9): 671-81.
  • Heo SK, et al. (2007) HVEM signaling in monocytes is mediated by intracellular calcium mobilization. J Immunol. 179(9): 6305-10.
  • Steinberg MW, et al. (2008) A crucial role for HVEM and BTLA in preventing intestinal inflammation. J Exp Med. 205(6): 1463-76.
  • Pasero C, et al. (2009) A role for HVEM, but not lymphotoxin-beta receptor, in LIGHT-induced tumor cell death and chemokine production. Eur J Immunol. 39(9): 2502-14.
  • Cheung TC. Modulation of T cell proliferation through the LIGHT-HVEM-BTLA cosignaling pathway. Recent Pat DNA Gene Seq. 3(3): 177-82.
  • TOP