Rat GPT1/GPT Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGD275-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1491bp
Gene Synonym
Gpt1, Gpt
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat glutamic-pyruvate transaminase (alanine aminotransferase) Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Alanine aminotransferase (ALT), also known as glutamate pyruvate transaminase (GPT), is a pyridoxal enzyme which belongs to the class-I pyridoxal-phosphate-dependent aminotransferase family, Alanine aminotransferase subfamily. Gpt / Gpt1 / ALT catalyses the reversible interconversion of L-alanine and 2-oxoglutalate to pyruvate and L-glutamate, and plays a key role in the intermediary metabolism of glucose and amino acids. Gpt / Gpt1 / ALT is expressed in Liver, kidney, heart, and skeletal muscles and it expresses at moderate levels in the adipose tissue. As a key enzyme for gluconeogenesis, Gpt is a widely-used serum marker for liver injury. Two ALT isoenzymes have been identified, ALT1 and ALT2 (GPT1 and GPT2), which are encoded by separate genes and share significant sequence homology, but differ in their expression patterns. GPT1/GPT is widely distributed and mainly expressed in intestine, liver, fat tissues, colon, muscle, and heart, in the order of high to low expression level. Serum activity levels of this enzyme are routinely used as a biomarker of liver injury caused by drug toxicity, infection, alcohol, and steatosis.
References
  • Bergmeyer HU, et al. (1978) Optimization of methods for aspartate aminotransferase and alanine aminotransferase. Clin Chem. 24(1): 58-73.
  • King MC, et al. (1980) Allele increasing susceptibility to human breast cancer may be linked to the glutamate-pyruvate transaminase locus. Science. 208(4442): 406-8.
  • Prati D, et al. (2002) Updated definitions of healthy ranges for serum alanine aminotransferase levels. Ann Intern Med. 137(1): 1-10.
  • TOP