Rat GM-CSF/CSF2 Gene ORF cDNA clone expression plasmid,C terminal His tag

Catalog Number:RGD157-CH

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
435bp
Gene Synonym
Gmcsf, Gm-csf, Csf2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat colony stimulating factor 2 (granulocyte-macrophage) Gene ORF cDNA clone expression plasmid,C terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is one of an array of cytokines with pivotal roles in embryo implantation and subsequent development. Several cell lineages in the reproductive tract and gestational tissues synthesise GM-CSF under direction by ovarian steroid hormones and signalling agents originating in male seminal fluid and the conceptus. The pre-implantation embryo, invading placental trophoblast cells and the abundant populations of leukocytes controlling maternal immune tolerance are all subject to GM-CSF regulation. GM-CSF stimulates the differentiation of hematopoietic progenitors to monocytes and neutrophils, and reduces the risk for febrile neutropenia in cancer patients. GM-CSF also has been shown to induce the differentiation of myeloid dendritic cells (DCs) that promote the development of T-helper type 1 (cellular) immune responses in cognate T cells. The active form of the protein is found extracellularly as a homodimer, and the encoding gene is localized to a related gene cluster at chromosome region 5q31 which is known to be associated with 5q-syndrome and acute myelogenous leukemia. As a part of the immune/inflammatory cascade, GM-CSF promotes Th1 biased immune response, angiogenesis, allergic inflammation, and the development of autoimmunity, and thus worthy of consideration for therapeutic target. GM-CSF has been utilized in the clinical management of multiple disease processes. Most recently, GM-CSF has been incorporated into the treatment of malignancies as a sole therapy, as well as a vaccine adjuvant. While the benefits of GM-CSF in this arena have been promising, recent reports have suggested the potential for GM-CSF to induce immune suppression and, thus, negatively impact outcomes in the management of cancer patients. GM-CSF deficiency in pregnancy adversely impacts fetal and placental development, as well as progeny viability and growth after birth, highlighting this cytokine as a central maternal determinant of pregnancy outcome with clinical relevance in human fertility.
References
  • Robertson SA. (2007) GM-CSF regulation of embryo development and pregnancy. Cytokine Growth Factor Rev. 18(3-4): 287-98.
  • Waller EK. (2007) The role of sargramostim (rhGM-CSF) as immunotherapy. Oncologist. 12 Suppl 2: 22-6.
  • Clive KS, et al. (2010) Use of GM-CSF as an adjuvant with cancer vaccines: beneficial or detrimental? Expert Rev Vaccines. 9(5): 519-25.
  • TOP