Rat GITR/TNFRSF18/CD357 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001024349.1

RefSeq ORF Size

366bp

Gene Synonym

Tnfrsf18

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 18 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

GITR, also known as TNFRSF18(CD357), belongs to the tumor necrosis factor receptor (TNF-R) superfamily. It is the receptor for TNFSF18. GITR plays a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells. GITR may be involved in interactions between activated T-lymphocytes and endothelial cells and in the regulation of T-cell receptor-mediated cell death. GITR and its ligand are important costimulatory molecules in the pathogenesis of autoimmune diseases. It also mediates NF-kappa-B activation via the TRAF2/NIK pathway.

References

Kwon B, et al. (1999) Identification of a novel activation-inducible protein of the tumor necrosis factor receptor superfamily and its ligand. J Biol Chem. 274(10):6056-61.

Nocentini G, et al. (1997) A new member of the tumor necrosis factor/nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci. 94(12): 6216-21.

Baltz KM, et al. (2007) Cancer immunoediting by GITR (glucocorticoid-induced TNF-related protein) ligand in humans: NK cell/tumor cell interactions. FASEB J. 21(10):2442-54.

Catalog Number:RGD113-NM