Rat Fractalkine/CX3CL1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:RGC900-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1182bp
Gene Synonym
Cx3c, Scyd1, Cx3cl1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat chemokine (C-X3-C motif) ligand 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fractalkine or Chemokine (C-X3-C motif) ligand 1 (CX3CL1) is a member of the CX3C chemokine family. Fractalkine / CX3CL1 is a unique chemokine that functions not only as a chemoattractant but also as an adhesion molecule and is expressed on endothelial cells activated by proinflammatory cytokines, such as interferon-gamma and tumor necrosis factor-alpha. Fractalkine/CX3CL1 is expressed in a membrane-bound form on activated endothelial cells and mediates attachment and firm adhesion of T cells, monocytes and NK cells. Fractalkine / CX3CL1 is associated with dendritic cells (DC) in epidermis and lymphoid organs. The fractalkine receptor, CX3CR1, is expressed on cytotoxic effector lymphocytes, including natural killer (NK) cells and cytotoxic T lymphocytes, which contain high levels of intracellular perforin and granzyme B, and on macrophages. Soluble fractalkine causes migration of NK cells, cytotoxic T lymphocytes, and macrophages, whereas the membrane-bound form captures and enhances the subsequent migration of these cells in response to secondary stimulation with other chemokines.
References
  • Imai T, et al. (1997) Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell. 91(4): 521-30.
  • Papadopoulos EJ, et al. (1999) Fractalkine, a CX3C chemokine, is expressed by dendritic cells and is up-regulated upon dendritic cell maturation. Eur J Immunol. 29 (8): 2551-9.
  • Umehara H, et al. (2004) Fractalkine in vascular biology: from basic research to clinical disease". Arterioscler. Thromb Vasc Biol. 24 (1): 34-40.
  • TOP