Rat Fetuin-A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

BC091118.1

RefSeq ORF Size

1059bp

Gene Synonym

pp63, Aa2-066

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat alpha-2-HS-glycoprotein Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Fetuin-A, also known as Alpha-2-HS-Glycoprotein (AHSG), belongs to the Fetuin family, is a plasma binding protein, and is more abundant in fetal than adult blood. It is involved in several functions, such as endocytosis, brain development and the formation of bone tissue. Fetuins are carrier proteins like albumin. Fetuin-A forms soluble complexes with calcium and phosphate and thus is a carrier of otherwise insoluble calcium phosphate. Thus Fetuin-A is a potent inhibitor of pathological calcification. The circulating levels of fetuin-A, a well-described inhibitor of calcification, regulate the cell-dependent process of osteogenesis. The low circulating fetuin-A levels are associated with a greater prevalence and/or severity of Vascular calcification (VC) and increased risk for all-cause and cardiovascular mortality. However, high circulating fetuin-A levels appear to induce insulin resistance and, in non-dialyzed subjects with diabetic nephropathy, are directly related to VC burden. The emerging role of fetuin-A deficiency as a risk factor in dialysis patients was documented in cross-sectional studies demonstrating a significant correlation with all-cause and cardiovascular mortality. Additionally, Human fetuin-A is a negative acute phase protein involved in inflammatory diseases, thus being a potential physiological regulator of meprin activity. Fetuin-A is a broad-range protease inhibitor. Fetuin-A and cystatin C as endogenous proteolytic regulators of meprin activity broadens our understanding of the proteolytic network in plasma.

References

Mehrotra R. (2007) Emerging role for fetuin-A as contributor to morbidity and mortality in chronic kidney disease. Kidney Int. 72(2): 137-40.

Westenfeld R, et al. (2007) Vascular calcification and fetuin-A deficiency in chronic kidney disease. Trends Cardiovasc Med. 17(4): 124-8.

Heiss A, et al. (2008). Hierarchical role of fetuin-A and acidic serum proteins in the formation and stabilization of calcium phosphate particles. J Biol Chem. 283 (21): 14815-25.

Jahnen-Dechent W, et al. (2008). Mineral chaperones: a role for fetuin-A and osteopontin in the inhibition and regression of pathologic calcification. J Mol Med. 86 (4): 379-89.

Hedrich J, et al. (2010) Fetuin-A and cystatin C are endogenous inhibitors of human meprin metalloproteases. Biochemistry. 49(39): 8599-607.

Catalog Number:RGC787-CM