Rat FDPS / Farnesyl Diphosphate Synthase Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_031840.1

RefSeq ORF Size

1062bp

Gene Synonym

FPS, Ac2-125

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat farnesyl diphosphate synthase Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Z-farnesyl diphosphate synthase (FDPS) is an enzyme belonging to the family of transferases, specifically those transferring aryl or alkyl groups other than methyl groups. Z-farnesyl diphosphate synthase (FDPS) functions as key enzyme in isoprenoid biosynthesis which catalyzes the formation of farnesyl diphosphate, a precurcor for several classes of essential metabolites. FDPS catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Functions of FDPS may be inactivated by interferon-induced RSAD2. This inactivation may result of disruption of lipid rafts at the plasma membrane, and thus have an antiviral effect since many enveloped viruses need lipid rafts to bud efficiently out of the cell.

References

Pjetursson BE, et al. (2007) Comparison of survival and complication rates of tooth-supported fixed dental prostheses (FDPs) and implant-supported FDPs and single crowns (SCs). Clin Oral Implants Res. 3:97-113.

Eschbach S, et al. (2009) Clinical evaluation of all-ceramic posterior three-unit FDPs made of In-Ceram Zirconia. Int J Prosthodont. 22(5):490-2.

Moshage HJ, et al. (1990) Differential effects of endotoxin and fibrinogen degradation products (FDPS) on liver synthesis of fibrinogen and albumin: evidence for the involvement of a novel monokine in the stimulation of fibrinogen synthesis induced by FDPS. Int J Biochem. 22(12): 1393-400.

Catalog Number:RGC776-NM