Rat ERBB4/HER4 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

AY375307.1

RefSeq ORF Size

3879bp

Gene Synonym

Erbb4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ERBB4 is a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. ERBB4 is expressed at highest levels in brain, heart, kidney, in addition to skeletal muscle, parathyroid, cerebellum, pituitary, spleen, testis and breast. And lower levels in thymus, lung, salivary gland, and pancreas. It specifically binds to and is activated by neuregulins, NRG-2, NRG-3, heparin-binding EGF-like growth factor, betacellulin and NTAK. ERBB4 also can be activated by other factors and induces a variety of cellular responses including mitogenesis and differentiation. ERBB4 regulates development of the heart, the central nervous system and the mammary gland, gene transcription, cell proliferation, differentiation, migration and apoptosis. It is required for normal cardiac muscle differentiation during embryonic development, and for postnatal cardiomyocyte proliferation. ERBB4 also play a role on the normal development of the embryonic central nervous system, especially for normal neural crest cell migration and normal axon guidance. It is required for mammary gland differentiation, induction of milk proteins and lactation.

References

Huang, Y Z, et al. (2000) Regulation of neuregulin signaling by PSD-95 interacting with ErbB4 at CNS synapses. Neuron. 26(2):443-55.

Garcia, R A, et al. (2000) The neuregulin receptor ErbB-4 interacts with PDZ-containing proteins at neuronal synapses. Proc Natl Acad Sci. 97(7):3596-601.

Silberberg G, et al. (2006) The involvement of ErbB4 with schizophrenia: association and expression studies. Am J Med Genet. 141(B2):142-8.

Sardi SP, et al. (2006) Presenilin-dependent ErbB4 nuclear signaling regulates the timing of astrogenesis in the developing brain. Cell. 127(1):185-97.

Catalog Number:RGC569-NM