Rat Ephrin-A5/EFNA5 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:RGC552-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
687bp
Gene Synonym
Lerk7, Efna5
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat EFNA5 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ephrin-A5 also known as EFNA5, is a member of the Ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. Ephrin-A5/EFNA5 may function actively to stimulate axon fasciculation. The interaction of EFNA5 with EPHA5 also mediates communication between pancreatic islet cells to regulate glucose-stimulated insulin secretion. Ephrin-A5/EFNA5 also serves as a cognate/functional ligand for EPHA7, their interaction regulates brain development modulating cell-cell adhesion and repulsion.
References
  • Frisén J, et al. (1998) Ephrin-A5 (AL-1/RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system. Neuron. 20(2): 235-43.
  • Feldheim DA, et al. (2000) Genetic analysis of ephrin-A2 and ephrin-A5 shows their requirement in multiple aspects of retinocollicular mapping. Neuron. 25(3): 563-74.
  • Wahl S, et al. (2000) Ephrin-A5 induces collapse of growth cones by activating Rho and Rho kinase. J Cell Biol. 149(2): 263-70.
  • TOP