Rat EphB6/Eph Receptor B6 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:RGC546-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3042bp
Gene Synonym
Ephb6
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat Eph receptor B6 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Ephrins are divided into the ephrin-A (EFNA) class and the ephrin-B (EFNB) class based on their structures and sequence relationships. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. EphB6 is an unusual Eph receptor, lacking catalytic capacity due to alterations in its kinase domain. Interestingly, increased metastatic activity is associated with reduced EphB6 receptor expression in several tumor types, including breast cancer. This emphasizes the potential of EphB6 to act as a suppressor of cancer aggressiveness. EphB6 suppress cancer invasiveness through c-Cbl-dependent signaling, morphologic changes, and cell attachment and indicate that EphB6 may represent a useful prognostic marker and a promising target for therapeutic approaches. EphB6 can both positively and negatively regulate cell adhesion and migration, and suggest that tyrosine phosphorylation of the receptor by an Src family kinase acts as the molecular switch for the functional transition. In addition, Ephrin-B2 may be a physiological ligand for the EphB6 receptor.
References
  • Munthe E, et al. (2000)Ephrin-B2 is a candidate ligand for the Eph receptor, EphB6. FEBS Lett. 466(1): 169-74.
  • Matsuoka H, et al. (2005) Biphasic functions of the kinase-defective Ephb6 receptor in cell adhesion and migration. J Biol Chem. 280(32): 29355-63.
  • Truitt L, et al. (2010) The EphB6 receptor cooperates with c-Cbl to regulate the behavior of breast cancer cells. Cancer Res. 70(3): 1141-53.
  • TOP