Rat Cystatin C / CST3 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:RGC023-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
423bp
Gene Synonym
CYSC, MGC105556, Cst3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat cystatin C Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cystatin C, also known as Cystatin-3 (CST3) is a secreted type 2 cysteine protease inhibitor synthesized in all nucleated cells, has been proposed as a replacement for serum creatinine for the assessment of renal function, particularly to detect small reductions in glomerular filtration rate. The mature, active form of human cystatin C is a single non-glycosylated polypeptide chain consisting of 120 amino acid residues, with a molecular mass of 13,343-13,359 Da, and containing four characteristic disulfide-paired cysteine residues. Cystatin C is a low-molecular-weight protein which has been proposed as a marker of renal function that could replace creatinine. Indeed, the concentration of Cystatin C is mainly determined by glomerular filtration and is particularly of interest in clinical settings where the relationship between creatinine production and muscle mass impairs the clinical performance of creatinine. Since the last decade, numerous studies have evaluated its potential use in measuring renal function in various populations. More recently, other potential developments for its clinical use have emerged. In almost all the clinical studies, Cystatin C demonstrated a better diagnostic accuracy than serum creatinine in discriminating normal from impaired kidney function, but controversial results have been obtained by comparing this protein with other indices of kidney disease, especially serum creatinine-based equations, such as early atherosclerosis, Alzheimer's dementia, vascular aneurysms, hyperhomocysteinaemia and other neurodegenerative diseases. Cystatin C could be a useful clinical tool to identify HIV-infected persons. In addition, its expression is up-regulated in malignance of certain tumor progression.
References
  • Mares J, et al. (2003) Use of cystatin C determination in clinical diagnostics. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 147(2): 177-80.
  • Mussap M, et al. (2004) Biochemistry and clinical role of human cystatin C. Crit Rev Clin Lab Sci. 41(5-6): 467-550.
  • Sronie-Vivien S, et al. (2008) Cystatin C: current position and future prospects. Clin Chem Lab Med. 46(12): 1664-86.
  • Taglieri N, et al. (2009) Cystatin C and cardiovascular risk. Clin Chem. 55(11): 1932-43.
  • TOP